Ginger SNPs

As part of the Royal Institution’s video Advent calendar series for 2013, ‘Chromosome’, I presented a little video about a gene on Chromosome 16, melanocortin 1 receptor (MC1R), called ‘Genetically Ginger’.

MC1R is perhaps the closest thing we have to a ‘ginger gene’. According to work by Valverde et al. in 1995, 82% of ginger-haired people have a variant of the MC1R gene with a single nucleotide different to the MC1R found in brown haired people. This amounts to 31 red-haired people with an MC1R variant out of the 38 sampled red-haired people. Just 11% of the black-haired people had a MC1R gene variant. The correlation between gene variant and hair colour isn’t exact but it’s fairly high. A causative link between the alteration in MC1R and ginger hair in humans has been difficult to prove but in 1999 Schioth et al. suggested that the gene variants found in red-haired people did indeed affect the protein receptors function, making it less responsive to the hormone (alpha-melanocyte stimulating hormone) that stimulates the dark pigment producing cells. However as they say in their discussion:

It, therefore, seems unlikely that this slight change in affinity is the cause of differences in skin and hair colour been found.

Their conclusion is rather tentative.

I presented one particular gene variant, one single nucleotide polymorphism or SNP, in the video as that was the most common ‘ginger’ variant in the Valverde et al. paper. I don’t know what my particular variant is, but it is likely that that sequence is my sequence. Pretty cool. And that is the wonder of molecular biology and genetics.

There are some excellent videos in the series, including one that on my favourite topic, circadian rhythms. Prof Russell Foster (who examined my PhD) presents some of the work on melanopsin in ‘What Regulates Our Body Clock?‘, one of the most important findings in circadian biology of the last 20 years.

‘Wild-type’ sequence:
ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA

‘My’ ginger hair sequence:
ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCCACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA

(look for 5 Cs in a row near the end of the sequence. The next letters to the left of the 5 Cs, reading from right to left, are A and G. In the ginger hair sequence they are A and C. The one letter, the single nucleotide polymorphism, that (may) gives rise to my ginger hair.)

Advertisements

3 thoughts on “Ginger SNPs”

    1. single nucleotide polymorphism – it just means a single DNA base that is changed, a spelling difference. For example: GTTTAGCCA to GTTTCGCCA, the SNP here is the 5th base, from A to C.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s